خرد سیارچہ

آزاد دائرۃ المعارف، ویکیپیڈیا سے
:چھلانگ بطرف رہنمائی، تلاش

خرد سیارچے (Microsatellites) ایسے DNA کے ٹکڑے یا قطعات ہوتے ہیں جنکو متکرر (motif) کہا جاتا اور ایسا کہنے کی وجہ یہ ہے کہ جیسے کسی بات یا شۓ کا کوئی موضوع بار بار اپنے آپ کو دہراتا ہے بالکل اسی طرح یہ متکرر (DNA کے قواعد) بھی خود کو دہراتے ہیں اور اپنی تکرار پیش کرتے ہیں۔ انکی یہ تکرار عام طور پر 2 تا 5 بار ہوتی ہے۔ آسان الفاظ میں یوں کہ سکتے ہیں کہ ڈی این اے کے چار قواعد (قاعدہ ڈی این اے کی اکائی کو کہا جاتا ہے) میں سے کوئی ایک ، دو یا تین یا چاروں (A G C T) اپنے آپ کو بار بار دہرائیں اور یہ تکرار ڈی این اے کے سالمے پر ایک قطار کی صورت پائی جاتی ہو۔ گو کہ انکی طوالت مختلف افراد میں مختلف ہوتی ہے مگر کسی ایک ہی انسان میں انکا ایک مستقل طوالت والا مجموعہ پایا جاتا ہے۔ انسان میں اکثر ملنے والا ایک خرد سیارچہ CA کی تکرار کا دونیوکلیوٹائڈ (dinucleotide) ہوتا ہے جو کہ انسان کے موارثہ (genome) میں ہزاروں مقامات پر پایا جاتا ہے۔ اس قسم کے CA کے تکراری خرد سیارچے کو (CA)n سے ظاہر کیا جاتا ہے۔

مثال[ترمیم]

درج ذیل میں DNA کا ایک ایسا قطعہ دیا گیا ہے کہ جس میں ایک خرد سیارچہ موجود ہے۔ جیسا کہ اوپر بیان آیا کہ خرد سیارچات کی ایک عام کیفیت یہ ہوتی ہے کہ اس میں CA کی تکراری متوالیہ (sequence) پایا جاتا ہے جو کہ اکثر 2 تا 5 بار کی تکرار ہوتی ہے جس کو درج ذیل ڈی این اے کے ٹکڑے میں سرخ رنگت سے ظاہر کیا گیا ہے۔

ATGCGCTCACACACACAGTGATCAC
TACGCGAGTGTGTGTGTCACTAGTG

اوپر دیۓ گۓ ڈی این اے کے متوالیہ میں CA تکراری خرد سیارچے کی طوالت 5 تکراری دیکھی جاسکتی ہے۔ مزید یہ کہ اس متوالیہ سے یہ بھی عیاں ہے کہ یہ ایک (CA)n قسم کا خرد سیارچہ ہے۔

یک ، دو اور سہ[ترمیم]

سب سے عام شکل جو کہ خرد سیارچوں کی اب تک کی سالماتی حیاتیات کی تحقیق سے سامنے آئی ہے وہ دو نیوکلیوٹائڈوں سے ملکر بنی ہوئی ہوتی ہے جسکو ظاہر ہے کہ دونیوکلیوٹائڈی (dinucleotide) کہا جاتا ہے کیونکہ اس میں دو نیوکلیوٹائڈ (عموماً C اور A) شامل ہوتے ہیں۔ بعض اوقات یہ خرد سیارچے صرف ایک ہی نیوکلیوٹائڈ کے متکرر (motif) یعنی تکرار پر بھی مشتمل ہوتے ہیں مثال کے طور پر 5 یا 6 یا زائد A کی تکرار، اور ایسی صورت میں انکو اس نیوکلیوٹائڈ کی علامت کے ساتھ ظاہر کیا جاتا یعنی A کیلیۓ (A)n لکھ کر ظاہر کیا جاتا ہے۔ ایسے ہی ایک نیوکلیوٹائڈ کے متکرر کو یک نیوکلیوٹائڈ (Mononucleotide) خرد سیارچہ کہا جاتا ہے۔ اگر یہ خرد سیارچے تین تین نیوکلیوٹائڈ کی تکرار سے بنے ہوں تو پھر انکو سہ نیوکلیوٹائڈ (Trinucleotide) خرد سیارچہ کہا جاتا ہے۔ سہ نیوکلیوٹائڈی خرد سیارچوں میں عموما بڑھنے کا رجحان دیکھنے میں آتا ہے۔ اگر خرد سیارچے غیر معمولی طور پر طویل اور یا پھر چھوٹے ہو جائیں تو انکی ایسی کیفیت کو خرد سیارچہ بےثباتی (Microsatellite instability) کہا جاتا ہے، ایسی کیفیت عام طور پر ڈی این اے میں کسی ضرر یا طفرہ (mutation) کی وجہ سے پیدا ہوسکتی ہے۔