خرد سیارچہ بیثباتی

آزاد دائرۃ المعارف، ویکیپیڈیا سے
:چھلانگ بطرف رہنمائی، تلاش
ڈی این اے کی متوالیت کا ایک مخطط رحلانی (Electropherogram) جو کہ خرد سیارچہ کی بے ثباتی کو ظاہر کرتا ہے۔ یہ اصل میں ھلامہ برقی رحلان کی نسبت والا ایک اختبار ہوتا ہے۔ (تفصیل کیلیۓ متن دیکھیۓ)

خرد سیارچہ بےثباتی (Microsatellite instability) جیسا کہ نام سے ظاہر ہے کہ خرد سیارچے (Microsatellite) کی بے ثباتی یا بے استقلالی کو کہا جاتا ہے۔ خرد سیارچے (Microsatellites) ایسے DNA کے ٹکڑے یا قطعات ہوتے ہیں کہ جو اپنی نوعیت میں تکراری ہوں۔ یعنی آسان الفاظ میں یوں کہ سکتے ہیں کہ ڈی این اے کے چار قواعد (قاعدہ ڈی این اے کی اکائی کو کہا جاتا ہے) میں سے کوئی ایک ، دو یا تین یا چاروں (A G C T) قواعد اپنی ترتیب کی تکرار کرتے ہیں، اور یہ تکرار ڈی این اے کے سالمے پر ایک قطار کی صورت پائی جاتی ہے۔ گو کہ انکی طوالت مختلف افراد میں مختلف ہوتی ہے مگر کسی ایک ہی انسان میں انکا ایک مستقل طوالت والا مجموعہ پایا جاتا ہے۔ انسان میں اکثر ملنے والا ایک خرد سیارچہ CA کی تکرار کا دونیوکلیوٹائڈ (dinucleotide) ہوتا ہے جو کہ انسان کے موارثہ (genome) میں ہزاروں مقامات پر پایا جاتا ہے۔

  • نمونۂ خرد سیارچہ

درج ذیل میں DNA کا ایک ایسا قطعہ دیا گیا ہے کہ جس میں ایک خرد سیارچہ موجود ہے۔ جیسا کہ اوپر بیان آیا کہ خرد سیارچات کی ایک عام کیفیت یہ ہوتی ہے کہ اس میں CA کی تکراری متوالیہ (sequence) پایا جاتا ہے جو کہ اکثر 2 تا 5 بار کی تکرار ہوتی ہے جس کو درج ذیل ڈی این اے کے ٹکڑے میں سرخ رنگت سے ظاہر کیا گیا ہے۔

ATGCGCTCACACACACAGTGATCAC
TACGCGAGTGTGTGTGTCACTAGTG

اوپر دیۓ گۓ ڈی این اے کے متوالیہ میں CA تکراری خرد سیارچے کی طوالت 5 تکراری دیکھی جاسکتی ہے۔

خرد سیارچہ سے خرد سیارچہ بیثباتی[ترمیم]

اب ہوتا یوں ہے کہ اگر ڈی این اے کو کسی وجہ سے ضرر پہنچی ہو اور اس میں کوئی طفرہ (mutation) پیدا ہو چکی ہو تو پھر ایسے ڈی این اے میں خلیات کی مرمت کا کام ناکارہ یا ضعیف ہو جاتا ہے چونکہ اس کے DNA میں طفرہ کی وجہ سے اس کے نظام میں پائی جانے والی کوئی ایک یا ایک سے زائد ایسے وراثے (genes) اپنا کام درست نہیں کرپاتے جو کہ سرطان کی سرکوبی کرنے والے وراثے (tumor suppressor genes) عام طور پر کرتے ہیں۔ اور ایسے خلیات کے ڈی این میں موجود خرد سیارچے (microsatellite) کے اندر بھی قواعد (bases) کی اغلاط جمع ہو جاتی ہیں ، یعنی اسکا مطلب یہ ہوا کہ انکی لمبائی یا تو بڑھ جاتی ہے یا پھر کم ہوجاتی ہے اور اسی قسم کے غیر معمولی طویل یا غیر معمولی چھوٹے خرد سیارچوں کی کیفیت یا موجودگی کو خرد سیارچہ بے ثباتی کہا جاتا ہے۔